99
|
Zymo Research
genomic dna clean & concentrator-10 Genomic Dna Clean & Concentrator 10, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/custom%40d4064%4035093273?v=Zymo+Research Average 99 stars, based on 1 article reviews
genomic dna clean & concentrator-10 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
99
|
Zymo Research
d5201 genomic dna clean concentrator zymo D5201 Genomic Dna Clean Concentrator Zymo, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-164-170?v=Zymo+Research Average 99 stars, based on 1 article reviews
d5201 genomic dna clean concentrator zymo - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
99
|
Bio-Rad
d4011 iscript select cdna synthesis kit biorad D4011 Iscript Select Cdna Synthesis Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-172-178?v=Bio-Rad Average 99 stars, based on 1 article reviews
d4011 iscript select cdna synthesis kit biorad - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
96
|
Zymo Research
genomic dna clean concentrator kit zymo research ref Genomic Dna Clean Concentrator Kit Zymo Research Ref, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm32234487-232-121-127?v=Zymo+Research Average 96 stars, based on 1 article reviews
genomic dna clean concentrator kit zymo research ref - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
90
|
HARTMANN ANALYTIC
g-32p-atp (3000 ci/mmol G 32p Atp (3000 Ci/Mmol, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35093273-218-137-133?v=HARTMANN+ANALYTIC Average 90 stars, based on 1 article reviews
g-32p-atp (3000 ci/mmol - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
HARTMANN ANALYTIC
a-32p-datp (3000 ci/mmol A 32p Datp (3000 Ci/Mmol, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35093273-218-145-149?v=HARTMANN+ANALYTIC Average 90 stars, based on 1 article reviews
a-32p-datp (3000 ci/mmol - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
86
|
Eurofins
gccgcgtaatacgactcactatagg agataaaatttg eurofins custom primer t7 7s r Gccgcgtaatacgactcactatagg Agataaaatttg Eurofins Custom Primer T7 7s R, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-265-267?v=Eurofins Average 86 stars, based on 1 article reviews
gccgcgtaatacgactcactatagg agataaaatttg eurofins custom primer t7 7s r - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
93
|
Jena Bioscience
highyield t7 atto488 rna labeling kit jena bioscience cat Highyield T7 Atto488 Rna Labeling Kit Jena Bioscience Cat, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-214-220?v=Jena+Bioscience Average 93 stars, based on 1 article reviews
highyield t7 atto488 rna labeling kit jena bioscience cat - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
99
|
Zymo Research
r1055 quickchange lighting multi site R1055 Quickchange Lighting Multi Site, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-203-201?v=Zymo+Research Average 99 stars, based on 1 article reviews
r1055 quickchange lighting multi site - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |