d4011 iscript select cdna synthesis kit biorad Search Results


99
Zymo Research genomic dna clean & concentrator-10
Genomic Dna Clean & Concentrator 10, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/custom%40d4064%4035093273?v=Zymo+Research
Average 99 stars, based on 1 article reviews
genomic dna clean & concentrator-10 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

99
Zymo Research d5201 genomic dna clean concentrator zymo
D5201 Genomic Dna Clean Concentrator Zymo, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-164-170?v=Zymo+Research
Average 99 stars, based on 1 article reviews
d5201 genomic dna clean concentrator zymo - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

99
Bio-Rad d4011 iscript select cdna synthesis kit biorad
D4011 Iscript Select Cdna Synthesis Kit Biorad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-172-178?v=Bio-Rad
Average 99 stars, based on 1 article reviews
d4011 iscript select cdna synthesis kit biorad - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

96
Zymo Research genomic dna clean concentrator kit zymo research ref
Genomic Dna Clean Concentrator Kit Zymo Research Ref, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm32234487-232-121-127?v=Zymo+Research
Average 96 stars, based on 1 article reviews
genomic dna clean concentrator kit zymo research ref - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

90
HARTMANN ANALYTIC g-32p-atp (3000 ci/mmol
G 32p Atp (3000 Ci/Mmol, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35093273-218-137-133?v=HARTMANN+ANALYTIC
Average 90 stars, based on 1 article reviews
g-32p-atp (3000 ci/mmol - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
HARTMANN ANALYTIC a-32p-datp (3000 ci/mmol
A 32p Datp (3000 Ci/Mmol, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35093273-218-145-149?v=HARTMANN+ANALYTIC
Average 90 stars, based on 1 article reviews
a-32p-datp (3000 ci/mmol - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

86
Eurofins gccgcgtaatacgactcactatagg agataaaatttg eurofins custom primer t7 7s r
Gccgcgtaatacgactcactatagg Agataaaatttg Eurofins Custom Primer T7 7s R, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-265-267?v=Eurofins
Average 86 stars, based on 1 article reviews
gccgcgtaatacgactcactatagg agataaaatttg eurofins custom primer t7 7s r - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Jena Bioscience highyield t7 atto488 rna labeling kit jena bioscience cat
Highyield T7 Atto488 Rna Labeling Kit Jena Bioscience Cat, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-214-220?v=Jena+Bioscience
Average 93 stars, based on 1 article reviews
highyield t7 atto488 rna labeling kit jena bioscience cat - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

99
Zymo Research r1055 quickchange lighting multi site
R1055 Quickchange Lighting Multi Site, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/d4011+iscript+select+cdna+synthesis+kit+biorad/pm35662414-218-203-201?v=Zymo+Research
Average 99 stars, based on 1 article reviews
r1055 quickchange lighting multi site - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

Image Search Results